Review



skeletal muscle cdna library  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa skeletal muscle cdna library
    Skeletal Muscle Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 270 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/skeletal+muscle+cdna+library/Human+Skeletal+Muscle+QUICK-Clone+cDNA/pmc03013090-100-41-45
    Average 94 stars, based on 270 article reviews
    skeletal muscle cdna library - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C
    Article Snippet: .. Briefly, a fragment encoding domains 15-24 was amplified by PCR from a human skeletal muscle cDNA library (Clontech) and cloned into a pEGFP-N3 vector. .. Subsequently, a fragment encoding ABD-d15 was amplified using a FLNC cDNA as a template (HP07616-ARi57A02, deposited by Seishi Kato, Research Institute of National Rehabilitation Center for Persons with Disabilities and provided by the RIKEN BioResource Center) and cloned via BclI restriction site in the partial FLNC clone to obtain a full-length construct.

    Article Title: Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C.
    Article Snippet: .. Briefly, a fragment encoding domains 15-24 was amplified by PCR from a human skeletal muscle cDNA library (Clontech) and cloned into a pEGFP-N3 vector. .. Subsequently, a fragment encoding ABD-d15 was amplified using a FLNC cDNA as a template (HP07616-ARi57A02, deposited by Seishi Kato, Research Institute of National Rehabilitation Center for Persons with Disabilities and provided by the RIKEN BioResource Center) and cloned via BclI restriction site in the partial FLNC clone to obtain a full-length construct.

    Polymerase Chain Reaction:

    Article Title: Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C
    Article Snippet: .. Briefly, a fragment encoding domains 15-24 was amplified by PCR from a human skeletal muscle cDNA library (Clontech) and cloned into a pEGFP-N3 vector. .. Subsequently, a fragment encoding ABD-d15 was amplified using a FLNC cDNA as a template (HP07616-ARi57A02, deposited by Seishi Kato, Research Institute of National Rehabilitation Center for Persons with Disabilities and provided by the RIKEN BioResource Center) and cloned via BclI restriction site in the partial FLNC clone to obtain a full-length construct.

    Article Title: Inhibitors of phosphodiesterase type 5A for reducing skeletal muscle fatigue, edema, and damage in a patient having muscle fatigue due to increased age or exercise
    Article Snippet: To direct skeletal and cardiac muscle-specific expression of ε-sarcoglycan in mice, an MCKεSGpA transgene was constructed: a 5′ blunt-ended ClaI-3′ XhoI fragment of the murine muscle-specific creatine kinase (MCK) 6.5-kb promoter/enhancer (Johnson et al. 1989), was ligated into pGem7Zf(+) (Promega) 5′ blunt-ended AatII NhoI sites. .. The full-length human ε-sarcoglycan cDNA (human and mouse ε-sarcoglycan are 96% identical) was PCR synthesized from a human skeletal muscle cDNA library (Clontech) and engineered with 5′ XhoI-3′ KpnI sites then ligated downstream of the MCK promoter. ..

    Article Title: Discovery of high-affinity BCL6-binding peptide and its structure-activity relationship.
    Article Snippet: B cell lymphoma 6 (BCL6) is a transcriptional repressor that interacts with its corepressors BcoR and SMRT.. Since this protein-protein interaction (PPI) induces activation and differentiation of B lymphocytes, BCL6 has been an attractive drug target for potential autoimmune disease treatments.. Here we report a novel BCL6 inhibitory peptide, F1324 (Ac-LWYTDIRMSWRVP-OH), which we discovered using phage display technology; we also discuss this peptide's structure-activity relationship (SAR).

    Article Title: Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C.
    Article Snippet: .. Briefly, a fragment encoding domains 15-24 was amplified by PCR from a human skeletal muscle cDNA library (Clontech) and cloned into a pEGFP-N3 vector. .. Subsequently, a fragment encoding ABD-d15 was amplified using a FLNC cDNA as a template (HP07616-ARi57A02, deposited by Seishi Kato, Research Institute of National Rehabilitation Center for Persons with Disabilities and provided by the RIKEN BioResource Center) and cloned via BclI restriction site in the partial FLNC clone to obtain a full-length construct.

    Article Title: Discovery of an Irreversible and Cell-Active BCL6 Inhibitor Selectively Targeting Cys53 Located at the Protein-Protein Interaction Interface.
    Article Snippet: Subscriber access provided by READING UNIV Biochemistry is published by the American Chemical Society.. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society.. Copyright © American Chemical Society.

    cDNA Library Assay:

    Article Title: Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C
    Article Snippet: .. Briefly, a fragment encoding domains 15-24 was amplified by PCR from a human skeletal muscle cDNA library (Clontech) and cloned into a pEGFP-N3 vector. .. Subsequently, a fragment encoding ABD-d15 was amplified using a FLNC cDNA as a template (HP07616-ARi57A02, deposited by Seishi Kato, Research Institute of National Rehabilitation Center for Persons with Disabilities and provided by the RIKEN BioResource Center) and cloned via BclI restriction site in the partial FLNC clone to obtain a full-length construct.

    Article Title: Myopalladin knockout mice develop cardiac dilation and show a maladaptive response to mechanical pressure overload
    Article Snippet: .. Briefly, the plasmid was transformed into the Saccharomyces cerevisiae L40 reporter strain and subsequently co- transformed with a human skeletal muscle cDNA library in the pGAD10 vector (HL4010AB; Clontech Laboratories). ..

    Article Title: The eEF1γ Subunit Contacts RNA Polymerase II and Binds Vimentin Promoter Region
    Article Snippet: .. For two-hybrid screening, the complete open reading frame (ORF) of human RPB3 was cloned into the BamHI restriction site of the vector pGBKT7 (Clontech, Palo Alto, CA) in frame with the GAL4 binding domain (BD) and used to screen a human skeletal muscle cDNA library (Clontech) as previously described . ..

    Article Title: Inhibitors of phosphodiesterase type 5A for reducing skeletal muscle fatigue, edema, and damage in a patient having muscle fatigue due to increased age or exercise
    Article Snippet: To direct skeletal and cardiac muscle-specific expression of ε-sarcoglycan in mice, an MCKεSGpA transgene was constructed: a 5′ blunt-ended ClaI-3′ XhoI fragment of the murine muscle-specific creatine kinase (MCK) 6.5-kb promoter/enhancer (Johnson et al. 1989), was ligated into pGem7Zf(+) (Promega) 5′ blunt-ended AatII NhoI sites. .. The full-length human ε-sarcoglycan cDNA (human and mouse ε-sarcoglycan are 96% identical) was PCR synthesized from a human skeletal muscle cDNA library (Clontech) and engineered with 5′ XhoI-3′ KpnI sites then ligated downstream of the MCK promoter. ..

    Article Title: Discovery of high-affinity BCL6-binding peptide and its structure-activity relationship.
    Article Snippet: B cell lymphoma 6 (BCL6) is a transcriptional repressor that interacts with its corepressors BcoR and SMRT.. Since this protein-protein interaction (PPI) induces activation and differentiation of B lymphocytes, BCL6 has been an attractive drug target for potential autoimmune disease treatments.. Here we report a novel BCL6 inhibitory peptide, F1324 (Ac-LWYTDIRMSWRVP-OH), which we discovered using phage display technology; we also discuss this peptide's structure-activity relationship (SAR).

    Article Title: Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C.
    Article Snippet: .. Briefly, a fragment encoding domains 15-24 was amplified by PCR from a human skeletal muscle cDNA library (Clontech) and cloned into a pEGFP-N3 vector. .. Subsequently, a fragment encoding ABD-d15 was amplified using a FLNC cDNA as a template (HP07616-ARi57A02, deposited by Seishi Kato, Research Institute of National Rehabilitation Center for Persons with Disabilities and provided by the RIKEN BioResource Center) and cloned via BclI restriction site in the partial FLNC clone to obtain a full-length construct.

    Article Title: Discovery of an Irreversible and Cell-Active BCL6 Inhibitor Selectively Targeting Cys53 Located at the Protein-Protein Interaction Interface.
    Article Snippet: Subscriber access provided by READING UNIV Biochemistry is published by the American Chemical Society.. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society.. Copyright © American Chemical Society.

    Article Title: Myopalladin knockout mice develop cardiac dilation and show a maladaptive response to mechanical pressure overload
    Article Snippet: .. Briefly, the plasmid was transformed into the Saccharomyces cerevisiae L40 reporter strain and subsequently co-transformed with a human skeletal muscle cDNA library in the pGAD10 vector (HL4010AB; Clontech Laboratories). ..

    Clone Assay:

    Article Title: Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C
    Article Snippet: .. Briefly, a fragment encoding domains 15-24 was amplified by PCR from a human skeletal muscle cDNA library (Clontech) and cloned into a pEGFP-N3 vector. .. Subsequently, a fragment encoding ABD-d15 was amplified using a FLNC cDNA as a template (HP07616-ARi57A02, deposited by Seishi Kato, Research Institute of National Rehabilitation Center for Persons with Disabilities and provided by the RIKEN BioResource Center) and cloned via BclI restriction site in the partial FLNC clone to obtain a full-length construct.

    Article Title: The eEF1γ Subunit Contacts RNA Polymerase II and Binds Vimentin Promoter Region
    Article Snippet: .. For two-hybrid screening, the complete open reading frame (ORF) of human RPB3 was cloned into the BamHI restriction site of the vector pGBKT7 (Clontech, Palo Alto, CA) in frame with the GAL4 binding domain (BD) and used to screen a human skeletal muscle cDNA library (Clontech) as previously described . ..

    Article Title: Phosphoproteomics identifies dual-site phosphorylation in an extended basophilic motif regulating FILIP1-mediated degradation of filamin-C.
    Article Snippet: .. Briefly, a fragment encoding domains 15-24 was amplified by PCR from a human skeletal muscle cDNA library (Clontech) and cloned into a pEGFP-N3 vector. .. Subsequently, a fragment encoding ABD-d15 was amplified using a FLNC cDNA as a template (HP07616-ARi57A02, deposited by Seishi Kato, Research Institute of National Rehabilitation Center for Persons with Disabilities and provided by the RIKEN BioResource Center) and cloned via BclI restriction site in the partial FLNC clone to obtain a full-length construct.

    Plasmid Preparation:

    Article Title: Myopalladin knockout mice develop cardiac dilation and show a maladaptive response to mechanical pressure overload
    Article Snippet: .. Briefly, the plasmid was transformed into the Saccharomyces cerevisiae L40 reporter strain and subsequently co- transformed with a human skeletal muscle cDNA library in the pGAD10 vector (HL4010AB; Clontech Laboratories). ..

    Article Title: Myopalladin knockout mice develop cardiac dilation and show a maladaptive response to mechanical pressure overload
    Article Snippet: .. Briefly, the plasmid was transformed into the Saccharomyces cerevisiae L40 reporter strain and subsequently co-transformed with a human skeletal muscle cDNA library in the pGAD10 vector (HL4010AB; Clontech Laboratories). ..

    Transformation Assay:

    Article Title: Myopalladin knockout mice develop cardiac dilation and show a maladaptive response to mechanical pressure overload
    Article Snippet: .. Briefly, the plasmid was transformed into the Saccharomyces cerevisiae L40 reporter strain and subsequently co- transformed with a human skeletal muscle cDNA library in the pGAD10 vector (HL4010AB; Clontech Laboratories). ..

    Article Title: Myopalladin knockout mice develop cardiac dilation and show a maladaptive response to mechanical pressure overload
    Article Snippet: .. Briefly, the plasmid was transformed into the Saccharomyces cerevisiae L40 reporter strain and subsequently co-transformed with a human skeletal muscle cDNA library in the pGAD10 vector (HL4010AB; Clontech Laboratories). ..

    Two Hybrid Screening:

    Article Title: The eEF1γ Subunit Contacts RNA Polymerase II and Binds Vimentin Promoter Region
    Article Snippet: .. For two-hybrid screening, the complete open reading frame (ORF) of human RPB3 was cloned into the BamHI restriction site of the vector pGBKT7 (Clontech, Palo Alto, CA) in frame with the GAL4 binding domain (BD) and used to screen a human skeletal muscle cDNA library (Clontech) as previously described . ..

    Binding Assay:

    Article Title: The eEF1γ Subunit Contacts RNA Polymerase II and Binds Vimentin Promoter Region
    Article Snippet: .. For two-hybrid screening, the complete open reading frame (ORF) of human RPB3 was cloned into the BamHI restriction site of the vector pGBKT7 (Clontech, Palo Alto, CA) in frame with the GAL4 binding domain (BD) and used to screen a human skeletal muscle cDNA library (Clontech) as previously described . ..

    Synthesized:

    Article Title: Inhibitors of phosphodiesterase type 5A for reducing skeletal muscle fatigue, edema, and damage in a patient having muscle fatigue due to increased age or exercise
    Article Snippet: To direct skeletal and cardiac muscle-specific expression of ε-sarcoglycan in mice, an MCKεSGpA transgene was constructed: a 5′ blunt-ended ClaI-3′ XhoI fragment of the murine muscle-specific creatine kinase (MCK) 6.5-kb promoter/enhancer (Johnson et al. 1989), was ligated into pGem7Zf(+) (Promega) 5′ blunt-ended AatII NhoI sites. .. The full-length human ε-sarcoglycan cDNA (human and mouse ε-sarcoglycan are 96% identical) was PCR synthesized from a human skeletal muscle cDNA library (Clontech) and engineered with 5′ XhoI-3′ KpnI sites then ligated downstream of the MCK promoter. ..

    Isolation:

    Article Title: Discovery of high-affinity BCL6-binding peptide and its structure-activity relationship.
    Article Snippet: B cell lymphoma 6 (BCL6) is a transcriptional repressor that interacts with its corepressors BcoR and SMRT.. Since this protein-protein interaction (PPI) induces activation and differentiation of B lymphocytes, BCL6 has been an attractive drug target for potential autoimmune disease treatments.. Here we report a novel BCL6 inhibitory peptide, F1324 (Ac-LWYTDIRMSWRVP-OH), which we discovered using phage display technology; we also discuss this peptide's structure-activity relationship (SAR).

    Article Title: Discovery of an Irreversible and Cell-Active BCL6 Inhibitor Selectively Targeting Cys53 Located at the Protein-Protein Interaction Interface.
    Article Snippet: Subscriber access provided by READING UNIV Biochemistry is published by the American Chemical Society.. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society.. Copyright © American Chemical Society.



    Similar Products

    94
    TaKaRa skeletal muscle cdna library
    Skeletal Muscle Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/skeletal+muscle+cdna+library/Human+Skeletal+Muscle+QUICK-Clone+cDNA/pmc03013090-100-41-45
    Average 94 stars, based on 1 article reviews
    skeletal muscle cdna library - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    OriGene mouse skeletal muscle cdna library dlm111
    Mouse Skeletal Muscle Cdna Library Dlm111, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/skeletal+muscle+cdna+library/mouse+skeletal+muscle+cdna+library+dlm111/pm37174658-96-8-15
    Average 90 stars, based on 1 article reviews
    mouse skeletal muscle cdna library dlm111 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    TaKaRa human cdna libraries
    <t>NBCn1-Exon</t> 7 amplified from human tissues. A. Nested primers designed from the human genome upstream of the MERF initiation site were used in PCR amplification of <t>cDNA</t> from skeletal muscle (lane 2) and kidney (lane 4) libraries. Products were separated on a 1% agarose gel. The products are ~3.7 kbp, as judged by comparison with the 1-kb ladder (lane 1). After sequencing, the bands were identified as genes encoding NBCn1 containing Exon 7. The isolated kidney clone is identical to that of the NBC3 clone reported by the Kurtz group , , except for various point mutations and polymorphisms. No clones were amplified from liver (lane 3) with these particular primers. B. Examples of NBCn1 clones with a MEAD initiation site are shown as amplified in skeletal muscle. Two bands (~3.4 kbp and ~3.7 kbp; lane 2) encoding NBCn1 were observed, as judged by comparison with the 2-log DNA marker (lane 1). The upper band encodes for NBCn1 with Exon 7, and the lower is without Exon 7. Similarly, an NBCn1-Exon 7 clone was amplified from liver (lane 4), and detected by internal gene-specific primers corresponding to an expected ~2.8-kbp product. C. A summary of the tissue distribution found for the Nt of NBCn1 clones (with and without Exon 7) is shown in all experiments. There appears to be a complementary distribution of expression between Nt-Exon 7 clones that begin with MEAD versus MERF. Large (easily detectable) and small (barely detectable)
    Human Cdna Libraries, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/skeletal+muscle+cdna+library/Human+Skeletal+Muscle+QUICK-Clone+cDNA/pmc04115197-29-10-23
    Average 94 stars, based on 1 article reviews
    human cdna libraries - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    TaKaRa human skeletal muscle cdna library

    Human Skeletal Muscle Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/skeletal+muscle+cdna+library/Human+Skeletal+Muscle+QUICK-Clone+cDNA/pmc08547954-59-4-14
    Average 94 stars, based on 1 article reviews
    human skeletal muscle cdna library - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    TaKaRa recombinant dna reagent human skeletal muscle cdna library

    Recombinant Dna Reagent Human Skeletal Muscle Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/skeletal+muscle+cdna+library/Human+Skeletal+Muscle+QUICK-Clone+cDNA/10__7554_slash_elife__58313-395-263-275
    Average 94 stars, based on 1 article reviews
    recombinant dna reagent human skeletal muscle cdna library - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    OriGene mouse skeletal muscle cdna library origene technologies
    <t>COBL</t> is a Z-disc associated protein in mouse skeletal muscle. A) Above, intron/exon structure of the mouse Cobl gene with exons numbered according to the predicted ENSEMBL Cobl-201 (ENSMUST00000046755.13). ENSEMBL Cobl-201 matches the sequence from the mouse <t>cDNA</t> amplified from a skeletal muscle library using the indicated primers (arrow tips). No shorter alternative COBL cDNAs were obtained. The mouse skeletal muscle cDNA predicts a protein of 1337 AA identical to UniProtKB Q5NBX1. Below, the mouse COBL protein with domains annotated as follows: Cobl, ubiquitin-like fold domain (IPR019025); Pro-rich, indicates a proline rich region (compositional bias); WH2, Wiskott-Aldrich homology 2 domain (IPR003124). The antigen used for anti-Cobl antibodies is indicated by the red bar. B) Western blot against COBL using a Gastrocnemius muscle and a 7-day differentiated C2C12 cell extracts confirms expression of COBL in mouse skeletal muscle tissue and in the C2C12 myoblast cell line. The asterisk indicates cross reactivity. C) Longitudinal cross-sections of mouse gastrocnemius muscle. Sections are from mice electroporated with a KY-TdTomato vector to identify the Z-disc (red) and incubated with anti-COBL antibody (green). Note that COBL antibodies identify a striated pattern that coincides with the z-disc as well as non-specific signals (white arrows). The insets (white squares) are shown magnified below. Scale bar is 50 μm. D) Sections from Tibialis Anterior muscle from mice electroporated with a COBL-Tdtomato recombinant cDNA (red) and incubated with EA-53 antibodies against alpha-actinin (green). Note that recombinant COBL-tdTomato also localizes to the Z-disc. Scale bar is 15 μm.
    Mouse Skeletal Muscle Cdna Library Origene Technologies, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/skeletal+muscle+cdna+library/mouse+skeletal+muscle+cdna+library+origene+technologies/pmc07584501-294-5-10
    Average 90 stars, based on 1 article reviews
    mouse skeletal muscle cdna library origene technologies - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    NBCn1-Exon 7 amplified from human tissues. A. Nested primers designed from the human genome upstream of the MERF initiation site were used in PCR amplification of cDNA from skeletal muscle (lane 2) and kidney (lane 4) libraries. Products were separated on a 1% agarose gel. The products are ~3.7 kbp, as judged by comparison with the 1-kb ladder (lane 1). After sequencing, the bands were identified as genes encoding NBCn1 containing Exon 7. The isolated kidney clone is identical to that of the NBC3 clone reported by the Kurtz group , , except for various point mutations and polymorphisms. No clones were amplified from liver (lane 3) with these particular primers. B. Examples of NBCn1 clones with a MEAD initiation site are shown as amplified in skeletal muscle. Two bands (~3.4 kbp and ~3.7 kbp; lane 2) encoding NBCn1 were observed, as judged by comparison with the 2-log DNA marker (lane 1). The upper band encodes for NBCn1 with Exon 7, and the lower is without Exon 7. Similarly, an NBCn1-Exon 7 clone was amplified from liver (lane 4), and detected by internal gene-specific primers corresponding to an expected ~2.8-kbp product. C. A summary of the tissue distribution found for the Nt of NBCn1 clones (with and without Exon 7) is shown in all experiments. There appears to be a complementary distribution of expression between Nt-Exon 7 clones that begin with MEAD versus MERF. Large (easily detectable) and small (barely detectable)

    Journal: International Journal of Biological Sciences

    Article Title: Direct Evidence for Calcineurin Binding to the Exon-7 Loop of the Sodium-Bicarbonate Cotransporter NBCn1

    doi: 10.7150/ijbs.9539

    Figure Lengend Snippet: NBCn1-Exon 7 amplified from human tissues. A. Nested primers designed from the human genome upstream of the MERF initiation site were used in PCR amplification of cDNA from skeletal muscle (lane 2) and kidney (lane 4) libraries. Products were separated on a 1% agarose gel. The products are ~3.7 kbp, as judged by comparison with the 1-kb ladder (lane 1). After sequencing, the bands were identified as genes encoding NBCn1 containing Exon 7. The isolated kidney clone is identical to that of the NBC3 clone reported by the Kurtz group , , except for various point mutations and polymorphisms. No clones were amplified from liver (lane 3) with these particular primers. B. Examples of NBCn1 clones with a MEAD initiation site are shown as amplified in skeletal muscle. Two bands (~3.4 kbp and ~3.7 kbp; lane 2) encoding NBCn1 were observed, as judged by comparison with the 2-log DNA marker (lane 1). The upper band encodes for NBCn1 with Exon 7, and the lower is without Exon 7. Similarly, an NBCn1-Exon 7 clone was amplified from liver (lane 4), and detected by internal gene-specific primers corresponding to an expected ~2.8-kbp product. C. A summary of the tissue distribution found for the Nt of NBCn1 clones (with and without Exon 7) is shown in all experiments. There appears to be a complementary distribution of expression between Nt-Exon 7 clones that begin with MEAD versus MERF. Large (easily detectable) and small (barely detectable) " + " signs indicate relative amplification intensity of signals using our primers.

    Article Snippet: NBCn1 splice variants were amplified by nested PCR reactions using human cDNA libraries, having adaptor-ligated AP1-ends, from kidney, skeletal muscle, and liver tissues (Clontech, CA).

    Techniques: Amplification, Agarose Gel Electrophoresis, Sequencing, Isolation, Clone Assay, Marker, Expressing

    Journal: eLife

    Article Title: Myopalladin knockout mice develop cardiac dilation and show a maladaptive response to mechanical pressure overload

    doi: 10.7554/eLife.58313

    Figure Lengend Snippet:

    Article Snippet: Recombinant DNA reagent , Human skeletal muscle cDNA library in the pGAD10 vector , Clontech Laboratories , HL4010AB , .

    Techniques: Knock-Out, Recombinant, Modification, Plasmid Preparation, cDNA Library Assay, Clone Assay, Sequencing, Labeling, DC Protein Assay, Transformation Assay, Protease Inhibitor, Western Blot, Staining, Software

    COBL is a Z-disc associated protein in mouse skeletal muscle. A) Above, intron/exon structure of the mouse Cobl gene with exons numbered according to the predicted ENSEMBL Cobl-201 (ENSMUST00000046755.13). ENSEMBL Cobl-201 matches the sequence from the mouse cDNA amplified from a skeletal muscle library using the indicated primers (arrow tips). No shorter alternative COBL cDNAs were obtained. The mouse skeletal muscle cDNA predicts a protein of 1337 AA identical to UniProtKB Q5NBX1. Below, the mouse COBL protein with domains annotated as follows: Cobl, ubiquitin-like fold domain (IPR019025); Pro-rich, indicates a proline rich region (compositional bias); WH2, Wiskott-Aldrich homology 2 domain (IPR003124). The antigen used for anti-Cobl antibodies is indicated by the red bar. B) Western blot against COBL using a Gastrocnemius muscle and a 7-day differentiated C2C12 cell extracts confirms expression of COBL in mouse skeletal muscle tissue and in the C2C12 myoblast cell line. The asterisk indicates cross reactivity. C) Longitudinal cross-sections of mouse gastrocnemius muscle. Sections are from mice electroporated with a KY-TdTomato vector to identify the Z-disc (red) and incubated with anti-COBL antibody (green). Note that COBL antibodies identify a striated pattern that coincides with the z-disc as well as non-specific signals (white arrows). The insets (white squares) are shown magnified below. Scale bar is 50 μm. D) Sections from Tibialis Anterior muscle from mice electroporated with a COBL-Tdtomato recombinant cDNA (red) and incubated with EA-53 antibodies against alpha-actinin (green). Note that recombinant COBL-tdTomato also localizes to the Z-disc. Scale bar is 15 μm.

    Journal: Experimental Cell Research

    Article Title: Proteomic resolution of IGFN1 complexes reveals a functional interaction with the actin nucleating protein COBL

    doi: 10.1016/j.yexcr.2020.112179

    Figure Lengend Snippet: COBL is a Z-disc associated protein in mouse skeletal muscle. A) Above, intron/exon structure of the mouse Cobl gene with exons numbered according to the predicted ENSEMBL Cobl-201 (ENSMUST00000046755.13). ENSEMBL Cobl-201 matches the sequence from the mouse cDNA amplified from a skeletal muscle library using the indicated primers (arrow tips). No shorter alternative COBL cDNAs were obtained. The mouse skeletal muscle cDNA predicts a protein of 1337 AA identical to UniProtKB Q5NBX1. Below, the mouse COBL protein with domains annotated as follows: Cobl, ubiquitin-like fold domain (IPR019025); Pro-rich, indicates a proline rich region (compositional bias); WH2, Wiskott-Aldrich homology 2 domain (IPR003124). The antigen used for anti-Cobl antibodies is indicated by the red bar. B) Western blot against COBL using a Gastrocnemius muscle and a 7-day differentiated C2C12 cell extracts confirms expression of COBL in mouse skeletal muscle tissue and in the C2C12 myoblast cell line. The asterisk indicates cross reactivity. C) Longitudinal cross-sections of mouse gastrocnemius muscle. Sections are from mice electroporated with a KY-TdTomato vector to identify the Z-disc (red) and incubated with anti-COBL antibody (green). Note that COBL antibodies identify a striated pattern that coincides with the z-disc as well as non-specific signals (white arrows). The insets (white squares) are shown magnified below. Scale bar is 50 μm. D) Sections from Tibialis Anterior muscle from mice electroporated with a COBL-Tdtomato recombinant cDNA (red) and incubated with EA-53 antibodies against alpha-actinin (green). Note that recombinant COBL-tdTomato also localizes to the Z-disc. Scale bar is 15 μm.

    Article Snippet: COBL was amplified from a mouse skeletal muscle cDNA library (OriGene Technologies, Inc.) using primers designed to leave blunt-end PCR products with a 5′ CACC to overlap with the GTGG overhang from the pENTR TOPO Vector (forward caccatggacgcgccgcgtgcactgg , reverse cacgagcaagggaacctttcttagt ).

    Techniques: Sequencing, Amplification, Ubiquitin Proteomics, Western Blot, Expressing, Plasmid Preparation, Incubation, Recombinant